Sekmadienis, 2021.09.19
Reklama

Trumpa genomo istorija

2012-09-25 14:45:09

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA GCGTATATTAAAGTTGCTGCAGTTAAAAAG

RNR ir DNR palyginimas
RNR ir DNR palyginimas. Technologijos.lt nuotr.

Atrodo lyg beprasmis raidžių kratinys, tačiau ši DNR seka yra išties nuostabi. Ji yra visose ląstelėse – jūsų kūno, jūsų katino ar šuns, žuvies jūsų lėkštėje, bičių ir drugelių sode ir bakterijų pilve. Iš tiesų, kur berastume gyvybę Žemėje – nuo verdančio vandens versmių vandenyno dugne iki sušalusių bakterijų aukštai skriejančiuose debesyse, atrasite ir šią seką. Ją galite aptikti netgi dariniuose, kurie nelaikomi gyvais, pavyzdžiui didžiuliuose virusuose, vadinamuose mimivirusais.

Ši seka yra taip paplitusi, nes evoliucionavo iš visų gyvybės formų bendro protėvio ir kadangi vykdo svarbų procesą, nuo to laiko nepasikeitė. Kitaip tariant, kai kurios jūsų DNR dalys yra neįsivaizduojamų 3 milijardų metų amžiaus, perduotos nenutrūkstančia trilijonų protėvių grandine.

Kitos jūsų DNR dalys gana naujos. Genome turite maždaug 100 mutacijų, kurių neturi jūsų motina ar tėvas, – nuo vienos ar dviejų kodo raidžių skirtumo iki didžiulių DNR gabalų gavimo ar praradimo.

Nustatyti, kurios DNR atkarpos yra naujos, kurios – senos, galime, lygindami genomus. Pavyzdžiui, lyginant jūsų genomą su brolių ar seserų, galima nustatyti naujas mutacijas. Žmonių ir gyvūnų genomo palyginimas atskleidžia daug senesnius pokyčius.

Tačiau mūsų genomai nėra vien žmonių gamybos receptai. Tai gyvi istoriniai įrašai. O, kadangi mūsų genomai tokie didžiuliai, sudaryti iš daugiau, nei 6 milijardų DNR raidžių – surašius jas visas, išeitų dešimčių metrų aukščio knygų krūva – mūsų praeitis juose užfiksuota itin detaliai. Tai leidžia atsekti mūsų evoliuciją nuo gyvybės aušros iki pat šių dienų.

Nors šiuos įrašus dar tik pradedame dešifruoti, jau išsiaiškinome, kad mūsų protėviams už išlikimą teko kovoti ne tik dantimis ir nagais. Įnirtingi mūšiai vyko ir mūsų genomuose. Šie mūšiai pakeitė genomų veikimą ir galiausiai padarė mus tokiais, kokie esame.

Bendras protėvis

Pradžioje buvo RNR. Ši daug talentų turinti molekulė gali saugoti informaciją ir katalizuoti reakcijas, o tai reiškia, kad kai kurios RNR gali save replikuoti. Vos tik viena RNR molekulė ar molekulių rinkinys ėmė save replikuoti, gimė pirmasis genomas.

Deja, RNR nėra itin stabili, tad gyvybė labai anksti persijungė prie informacijos saugojimo molekulėje, kurios šiek tiek kitoks cheminis karkasas taip lengvai netrūkinėdavo – DNR. Baltymai pakeitė RNR kaip katalizatorių, palikdami jai tarpininko vaidmenį. DNR saugojo baltymų gamybos receptus ir siųsdavo jų RNR kopijas baltymų gamybos aparatui.

Daug senojo, RNR valdomo pasaulio pėdsakų likę mūsų genome. Pavyzdžiui, straipsnio pradžioje parašyta visur esanti seka koduoja dalį RNR fermento, tebevaidinančio svarbų vaidmenį baltymų sintezėje.

Maždaug prieš 3,5 milijardus metų išsivystė gyvybės forma, turinti RNR ir baltymų gamybos receptų genomą – paskutinysis visuotinis bendras visos gyvybės protėvis (the Last Universal Common Ancestor – LUCA). Mažiausiai 100 genų galima užtikrintai atsekti iki LUCA, tvirtina Eugene`as Kooninas iš Nacionalinio sveikatos instituto Bethesda`oje, Merilende, studijuojantis gyvybės evoliuciją, ir LUCA tikriausiai iš viso turėjo daugiau, nei 1000 genų.

LUCA turėjo daug esminių funkcijų, randamų ir visoje

dabartinėje gyvybėje, tarp kurių ir baltymų gamyba.

Tačiau tai galėjo būti gyvybė, gana nepanaši į dabartinę. Kai kurie tyrėjai mano, kad LUCA visai nebuvo atskira, membranos ribojama ląstelė, o veikiau į virusus panašių elementų besidauginanti visuma kažkokioje negyvoje erdvėje, pavyzdžiui, šarminių hidroterminių šaltinių porose.

Skilimas ir susijungimas

Mitochondrija
Mitochondrija. Technologijos.lt nuotr.

Pagal vieną tikėtiną scenarijų, kitoje stadijoje LUCA`os į virusus panašūs elementai du atskirus kartus suskilo, įgaudami ląstelių membraną ir tapdami paprastomis ląstelėmis. Tai paaiškintų, kodėl yra dvi vienaląsčių rūšys – bakterijos ir archėjai –, turinčios visiškai skirtingą ląstelių membraną. „Tai labai patraukli hipotezė,“ sako Kooninas. Bet neabejojama, kad gyvybės skilimas į dvi pagrindines šakas įvyko labai anksti.

Bakterijos ir archėjai išvystė stulbinančius molekulinius mechanizmus ir pakeitė planetą, bet tebebuvo nedaug daugiau, nei mažyčiai chemikalų maišeliai. Tai tęsėsi, kol nepaprastas įvykis sujungė dvi šakas iš naujo ir atsirado sudėtingos ląstelės, kitaip – eukariotai. Šis įvykis pakeitė genomą ir nutiesė kelią pirmųjų gyvūnų evoliucijai.

Maždaug prieš milijardą metų bakterija atsidūrė archėjo viduje. Užuot vienas kitą nužudę, jie sukūrė simbiotinius santykius, kur bakterijų palikuoniai palaipsniui prisitaikė atlikti svarbų vaidmenį: jie tapo mitochondrijomis, ląstelių energijos fabrikais.

Be šios sąjungos sudėtinga gyvybė tikriausiai nebūtų išsivysčiusi visai. Mes linkę manyti, kad paprastiems organizmams natūralu vystytis į sudėtingesnius, bet atskiros bakterijos ir archėjai niekada neišsivystė labiau, nei tam tikras sudėtingumo lygis. Kodėl?

Pasak Nicko Lane`o iš UCL, taip yra dėl energijos barjero. Visi paprasti organizmai kuria energiją ląstelės membrana. Joms augant, mažėja paviršiaus ploto santykis su tūriu, tad tampa sunkiau pasigaminti pakankamai energijos. Dėl to vienaląsčiai turi likti maži, o mažose ląstelėse neužtenka vietos dideliam genomui. Mitochondrijos pašalino šį barjerą, sukurdamos modulinį energijos šaltinį. Dabar ląstelės galėjo augti, paprasčiausiai gamindamos daugiau mitochondrijų, o tai leido joms plėsti genomą ir tuo pačiu – saugoti daugiau informacijos.

Nepaisant akivaizdaus pranašumo, šios sandraugos sudarymas buvo kupinas pavojų. Konkrečiau, protėvinių mitochondrijų genomas buvo užkrėstas parazitinės DNR gabalais, kitaip – transpozonais, kurie nieko neveikė, tik kūrė savo kopijas. Kartais jie atsidurdavo genų viduryje, palikdami ten didelius nesusijusios DNR gabalus, – intronus. Tai tas pats, lyg įklijuoti sriubos receptą į pyrago receptą.

Tačiau rezultatas ne visada būdavo nelaimės receptas, nes šie intronai buvo „saviskaldžiai“: po to, kai buvo padaroma geno RNR kopija – pirmasis baltymų kūrimo proceso žingsnis – jie patys atsiskirdavo. Tačiau taip atsitikdavo ne visada, tad jie kenkdavo. Daugumos bakterijų genuose intronų nėra, nes didelėse populiacijose, kur stipri konkurencija, stipri natūralioji atranka juos išravi. Bet protėvinių eukariotų populiacija buvo labai maža, tad atranka buvo silpna. Genetiniai parazitai, atklydę kartu su mitochondrijų protėviais, pradėjo replikuotis kaip pašėlę, pagrindinį genomą užteršdami šimtais intronų.

Dabar kiekviename mūsų gene yra maždaug aštuoni intronai, daugelis kurių mena pačius pirmuosius eukariotus – mūsų pirmtakai taip ir nesugebėjo jais atsikratyti. Vietoje to, sukūrė atsikratymo būdus, pakeitusius mūsų genų struktūrą ir ląstelių dauginimąsi. Vienas tų būdų buvo lytis.

Sekso privalumai

Kertinis lytinio dauginimosi aspektas yra ne vien skirtingų individų genų sumaišymas, svarbus dėl

evoliucinių pranašumų, atsiradusių skirtingose genų linijose, apjungimo – paprastos ląstelės seniausiai mainydavosi genais, neapsunkindamos savęs seksu. Tai yra ir rekombinacijos procesas, kai chromosomų poros, prieš pasidalindamos į spermą ar kiaušinėlius, apsikeičia atitinkamais kodo gabalais. Rekombinacija padeda išspręsti fundamentalią problemą, kai genomas susideda iš daugelio genų, susijusių, kaip rutuliukai ant vėrinio.

Įsivaizduokite vėrinį, kurioje tikrai nuostabaus grožio perlas yra šalia netikusio. Jei negalima pakeisti perlo kitu, tenka atsikratyti viso vėrinio arba naudoti tokį vėrinį, koks yra. Panašiai yra ir genuose. Jei naudinga mutacija atsiduria šalia kenksmingos, tai arba naudinga mutacija bus prarasta, arba kenksmingoji paplis populiacijoje, traukiama savo kaimynės.

Rekombinacija suteikia galimybę pakeisti perlus. Lygiai, kaip galite padaryti vieną tobulą vėrinį ir vieną – su defektais, taip ir kai kurios atžalos turės neproporcingai daug gerų genų, tuo tarpu kitos – blogų, galbūt su trukdančias intronais. Nesėkmingieji individai tikriausiai išmirs, o su gerais genais – klestės.

Didelėse populiacijose vyksta tiek daug mutacijų, kad kai kurios priešinasi žalingo geno veikimui, tad nėra reikalo griebtis rekombinacijos. Bet mažose populiacijose seksas naudingas. Todėl tai tapo norma pirmiesiems eukariotams ir taip – daugumai jų palikuonių. Tad kitą kartą mylėdamiesi galite geru žodžiu paminėti genetinius parazitus, susigriebtus senovinių bakterinių protėvių.

Seksui išsivysčius, buvo jau pernelyg daug intronų, kad būtų įmanoma jų visų atsikratyti. Ankstyviesiems eukariotams greitai iškilo kita rimta problema: intronuose kaupiantis mutacijoms, savaiminio atsiskyrimo mechanizmas pradėjo strigti. Tad ankstyviesiems eukariotams išsivystė specialūs mechanizmai – splaisosomos, – gebantys iškirpti intronus iš geno RNR kopijų.

Splaisosomos yra kvailas sprendimas, būdingas evoliucijai: valyti geno RNR kopijas, užuot pašalinus šiukšles tiesiogiai iš DNR, – labai neefektyvu. O be to, splaisosomos yra lėtos. Daug RNR pasiekia baltymų gamyklas dar prieš tai, kai iš jų pašalinami intronai, tad, susidaro daug baltymų su defektais.

Kooninas spėja, kad tai buvo priežastis, paskatinusi branduolio išsivystymą. Kai ląstelės DNR buvo atskirta nuo baltymų gamybos mechanizmo, būdavo išleidžiamos tik apvalytos RNR, tad ląstelei nebereikėdavo švaistyti energijos, gaminant bereikalingus baltymus.

Tačiau netgi tai neišsprendė visų problemų. Splaisosomos per klaidą dažnai iškirpdavo koduojančias geno dalis – eksonus, tad susidarydavo mutavusios baltymo versijos. „Alternatyvus splaisingas nebuvo prisitaikymas,“ sako Kooninas. „Tai buvo kažkas, su kuo organizmai turėjo susitaikyti.“

Tad mūsų senoviniams protėviams žingsnis po žingsnio išsivystęs daugiasluoksnis mechanizmas, turėjęs susitvarkyti su intronų plitimu, vis tiek negalėjo išspręsti visų jų sukeltų problemų. Bet kitaip, nei paprastos ląstelės, jie galėjo sau leisti tokį švaistūniškumą, kadangi turėjo energijos, o ilgainiui visas šis perdėtas sudėtingumas suteikė naujas galimybes.

Įvairialypiškumas ir kontrolė

Dėl intronų ir dėl to – eksonų, genai iš esmės pasidarė moduliniai. Nepertrūkstamame gene sekas pridedančios ar pašalinančios mutacijos paprastai pakeičia ir likusio geno nuskaitymo tvarką, tad gaunasi beprasmė maišalynė. O tuo tarpu eksonai gali persikelti, nesutrikdydami geno likučio. Genai galėjo vystytis, perstumdydami eksonus ir jais keisdamiesi.

Tarkime, atsitiktinė mutacija prie geno prideda papildomą eksoną. Dėl alternatyvaus splaisingo, originalioji geno versija vis tiek gali būti gaminama, bet kartu sukuriamas dar ir naujas baltymas (žr. „Pjaustykla“).

Mutacija gali turėti nežymų poveikį, tad atranka jos neeliminuos, bet laikui bėgant, naujasis baltymas gali įgyti naują funkciją. Taip atsitiktinai eukariotų neprotingos pastangos susitvarkyti su intronais padarė jų genus daugiatiksliais ir labiau prisitaikančiais.

Jei šis požiūris į sudėtingų ląstelių evoliuciją teisingas, daugelis svarbiausių mūsų genomo savybių, nuo modulinių genų iki sekso, išsivystė kaip tiesioginė parazitų turinčių mitochondrijų gavimo pasekmė. Alternatyvių idėjų paneigti negalima, bet nė viena jų nepateikia tokio gražaus paaiškinimo. „Tai mano mėgstamiausias scenarijus,“ sako Kooninas.

Visos šios naujos savybės sukėlė evoliucinių inovacijų pliūpsnį, eukariotai klestėjo ir greitai pradėjo diversifikuotis. Tačiau jie vis tiek susidurdavo su nenuilstančia naujų rūšių parazitinių DNR ir virusų ataka. Tačiau, peržengusios paprastų ląstelių dydžio apribojimus, sudėtingos ląstelės galėjo vystyti sudėtingesnius gynybos mechanizmus.

Galima „nutildyti“ transpozonų parazitinius genus, prie DNR pridedant žymeklius, stabdančius RNR kopijų gaminimą – šis procesas vadinasi metiliavimas. Kitas gynybos nuo besiskverbiančių virusų būdas yra jų RNR sunaikinimas, taip neleidžiant jiems dalintis. Šios gynybos taktikos buvo sėkmingos tik iš dalies. Dabar maždaug 5 % žmogaus genomo yra mutavusios ir dažniausiai inertiškos virusų liekanos, o stulbinančius 50 % sudaro transpozonų likučiai, kurie yra kaip atminimas apie daugybę kartų, kai šiems parazitams kažkaip pavykdavo pakliūti į mūsų protėvių genomus ir netrukdomiems veikti.

Toks apsaugos mechanizmas greitai buvo pajungtas kitam tikslui: pačios ląstelės genų aktyvumo kontrolei. „Transpozonų kontrolės mechanizmai tapo genų kontrolės mechanizmais,“ apibendrina Ryanas Gregory`is iš Guelpho universiteto Kanadoje, studijuojantis genomų evoliuciją.

Kūnų statyba

Ląstelėms pradėjus bendradarbiauti artimiau, nei bet kada, maždaug prieš 800 milijonų metų, scena buvo paruošta kitam dideliam evoliucijos žingsniui. Nors keletas bakterijų yra daugialąstės, tačiau toliau eiti šiuo keliu vis neleido jų sudėtingumo apribojimai. Tuo tarpu eukariotai daugialąstiškumą išvystė ne kartą, pradėdami daug ypač sudėtingų organizmų linijų – grybų, jūržolių, sausumos augalų ir, žinoma, gyvūnų.

Viena iš priežasčių buvo didesnis genų repertuaras, kuris galėjo būti pasitelktas naujiems tikslams, tarkim, ląstelių susijungimui ir tarpusavio komunikavimui. O dar svarbiau, kad modulinė jų genų prigimtis leido spartesnę evoliuciją. Pavyzdžiui, ląsteles kartu jungiantys baltymai susideda iš ląstelės membraną supančios dalies ir į išorę išsikišusios dalies. Dėl modulinių genų, įvairiausios išorinės dalys gali būti pritaikytos membraną supančiai daliai, kaip skirtingi antgaliai dulkių siurbliui. Daugelis daugialąstiškumui svarbių genų išsivystė per eksonų maišymą.

Be to, sudėtingesnis eukariotų genų kontrolės mechanizmas galėjo būti panaudotas ląstelių specializavimuisi. Įjungiant ir išjungiant skirtingas genų sekas, skirtingos ląstelių grupės galėjo vaidinti skirtingus vaidmenis. Dėl to organizmai galėjo pradėti vystyti skirtingus audinius, leidusius ankstyviesiems gyvūnams evoliucionuoti iš paprastų kempines primenančių sutvėrimų į vis sudėtingesnę kūno sandarą turinčius gyvūnus.

Kitas šuolis įvyko dėl poros genetinių atsitiktinumų. Kai dauginantis reikalai vyksta ne taip, kaip derėtų, kartais visas genomas duplikuojasi – taip nutiko ir ne kartą, o du visų stuburinių gyvūnų protėviui. Šie genomo dublikatai suteikė daug papildomų genų kopijų. Daugelis jų buvo prarasti, tačiau kiti pakeitė paskirtį. O būtent, duplikavimas sukūrė keturias genų

sankaupas, vadovaujančias kūno plano išdėstymui vystantis – Hox genus – ir manoma, kad šios sankaupos vaidino svarbų vaidmenį, vystantis vidiniam skeletui. Nors viso genomo duplikavimas yra retas, daugelis naujų genų atsiranda dėl mažesnių duplikavimųsi ar dėl eksonų maišos arba dėl abiejų šių faktorių. Evoliucija yra begėdė – ji išnaudoja bet kokią DNR, duodančią kokią nors naudą, ir nesvarbu, iš kur ji paimta. Kai kurie svarbūs genai išsivystė iš DNR atliekų, tuo tarpu kiti buvo pačiupti iš kitur. Pavyzdžiui, maždaug prieš 500 milijonų metų į mūsų protėvių genomą įsibrovė genetinis parazitas, vadinamasis hAT transpozonas, kopijuojantis save „iškirpk ir padėk“ metodu. Karpymas atliekamas dviem fermentais, prisitvirtinusiais prie tam tikrų DNR sekų. Kažkuriuo metu pirmuosiuose stuburiniuose šios DNR karpymo fermentų sekos atsidūrė šalia geno (arba jame pačiame), susijusio su besibraunančių bakterijų ir virusų atpažinimu. Dėl to organizme dalinantis ląstelėms, hAT iškarpė geno dalis. Svarbiausia, skirtingose genų linijose buvo iškarpyti skirtingi gabaliukai – atsirado daug mutavusių baltymo versijų. Kai kuriais atvejais tai buvo gyvybę gelbstintis pokytis, nes mutavę genai geriau prisitvirtindavo prie įsibrovusių patogenų. Greitai išsivystė mechanizmas, skirtas efektyviausius baltymus gaminančių ląstelių atpažinimui ir jų dauginimosi skatinimui – prisitaikanti imuninė sistema. Žmogaus imuninė sistema dabar yra beprotiškai sudėtinga, tačiau du fermentai, karpantys ir perstumdantys genus – tai būtinos kovos su įsibrovėliais priemonės – yra tiesioginiai hAT fermento palikuoniai . Tad reikia dėkoti senoviniam parazitui už mūsų efektyviausią ginklą prieš ligas.

Žmogaus genomas

Apsiginklavę tokia pažangia gynyba ir turėdami genetinius įrankius, galinčius suteikti tokią įvairią kūno formą, pirmieji stuburiniai buvo labai sėkmingi. Jie užkariavo jūras, kolonizavo sausumą, įsiropštė į medžius, o tada nulipo žemyn ir pradėjo vaikščioti dviem kojomis.

Kodėl mes taip skiriamės nuo kitų beždžionių? Tarp mūsų yra vienas, regis, didelis skirtumas: mes turime 23 chromosomas, o ne 24, kaip mūsų beždžioninis protėvis. Bet chromosomos iš esmės tėra maišai su genais ir nėra didelio skirtumo ar jie išsibarstę plačiau, ar glaudžiau, jei tik yra visi reikalingi genai. Tad, panašu, daug mažų pokyčių pamažu pakeitė mūsų smegenis ir kūnus. Kai kurias mutacijas jau atsekėme, bet jų gali būti daug tūkstančių.

Žvelgiant atgal, aiškėja, kad ląstelių ir kūnų sudėtingumas prasidėjo, išaugus genomo sudėtingumui. Tačiau stebina tai, kad daugelis šių sudėtingumo padidėjimų įvyko ne dėl evoliucinės atrankos, o dėl jos trūkumo. „Didžioji dalis genome vykstančių pokyčių tikriausiai yra neutralūs,“ sako Gregory`is.

Kitais žodžiais tariant, kyla mutacijos, darančios mažą poveikį, – jei išvis kokį nors –, pavyzdžiui, genų duplikavimasis. Didelėje populiacijoje tokie pokyčiai būtų greitai prarasti. Bet mažoje populiacijoje jie gali plisti atsitiktinai, per genų dreifą. „Tai neišvengiama populiacijų genetikos pasekmė,“ paaiškina Kooninas. Toks sudėtingumas atrenkamas vėliau, pavyzdžiui, genui gavus naują paskirtį.

Daug svarbių mūsų istorijos momentų, kaip genomo duplikavimasis, sukūręs mūsų Hox genus, gali būti kilę dėl silpnos atrankos mažose populiacijose. Išties, tokie populiacijų „butelio kakliukai“ pačioje žmonių evoliucijos pradžioje gali paaiškinti paplitimą kai kurių mutacijų, skiriančių mus nuo beždžionių, tarkime, raumenų jėgos sumenkimą.

Kitas nuostabus dalykas, tai didžiulis virusų ir parazitų vaidmuo. Daugelis pagrindinių mūsų genomo savybių, nuo lyties iki metiliavimo,

išsivystė kaip atsakas į jų atakas. Dar daugiau, nemažai mūsų genų ir eksonų, pavyzdžiui, imuniteto fermentai, kilo tiesiogiai iš šių užpuolikų. „Virusai buvo būtina ląstelinės gyvybės dalis nuo pat pradžios,“ pažymi Kooninas.

Būtina, bet ne maloni. Mūsų evoliucijos kaštai didžiuliai. Sakoma, istoriją rašo nugalėtojai – ką gi, mūsų genomas yra pergalių, pavykusių eksperimentų (ar bent jau nenužudžiusių mūsų protėvių), metraštis. Esame ilgos loterijos laimėtojų linijos palikuonys, loterijos, kurios prizas – atžalos, išgyvenančios pakankamai ilgai, kad susilauktų savo palikuonių. Šiame žaidime buvo nesuskaičiuojama daugybė nesėkmių, kai trilijonai gyvūnų žūdavo dažnai siaubingomis mirtimis.

Mūsų genomas toli gražu nėra nudailintas, baigtas produktas. Veikiau jau grubiai sudurstytas iš genetinių avarijų nuolaužų ir senovinių parazitų liekanų. Tai rezultatas beprotiško, nekontroliuojamo eksperimento, kurį nesvarstydama atmestų bet kokia etikos taryba. Šis procesas tęsiasi ir dabar – nuvykite į bet kurią ligoninę ir tikriausiai išvysite vaikus, mirštančius nuo siaubingų genetinių ligų. Bet miršta ne tiek daug, kiek mirdavo anksčiau. Tarkime, per embrionų patikrą pradedame kontroliuoti žmogaus genomo evoliuciją. Brėkšta nauja aušra.

Žodynas:

Archėjai - viena iš dviejų vienaląsčių organizmų rūšių;

Bakterijos - viena iš dviejų vienaląsčių organizmų rūšių;

Eukariotas - sudėtinga ląstelė su būdinga vidine struktūra;

Eksonas - viena iš koduojančių baltymą geno dalių;

Genas - baltymo ar funkcinės RNR kūrimo receptas;

Intronas - geno dalis, nekoduojanti baltymo. Intronai paprastai būna iškerpami iš geno RNR kopijos prieš šiai pasiekiant baltymo gamybos vietą.

LUCA - Paskutinis visuotinis bendras protėvis (Last Universal Common Ancestor)

Splaisingas - intronų šalinimo iš RNR procesas;

Transpozonas - genetinis parazitas. Jame yra fermentų kodas, leidžiantis kopijuoti ir įterpti save į kitas genomo dalis.

Michael Le Page yra New Scientist biologijos skyriaus redaktorius.

New Scientist № 2882

Vytautas Povilaitis

technologijos.lt

Įvertinkite straipsni:
Jūs dar nebalsavote
Žymos: genai, genomas
Kategorijos: Įvairios naujienos
skaityti komentarus (0)
Rašyti komentarą
Pasidalinti su draugais

Susiję straipsniai

NAUJAUSI STRAIPSNIAI
Kokie organizmo siunčiami ženklai informuoja apie nusilpusį imunitetą?
Stresas, miego ir poilsio trūkumas, netinkama mityba, žalingi įpročiai – visa tai alina imunitetą. Silpna, o dėl t...
Aknė – ne vien paauglių problema, kenčia vis daugiau vyresnių moterų ir vyrų
Aknė nėra paprastas bėrimas, kaip ir nėra vien tik paauglių problema. Taip, 9 iš 10 paauglių kenčia nuo aknės, tačiau ty...
Klaidos naudojant skutimosi peiliukus gali sudirginti odą
Skutimosi peiliukai – bene dažniausiai naudojama nepageidaujamų plaukelių šalinimo priemonė. Tiesa, šis greitas de...
Operacinės instrumentatorė: "Mums nebūtina daug šnekėtis"
Pavykusi operacija yra darnaus operacinės komandos darbo rezultatas, todėl operacinės slaugytoja-instrumentatorė Dalia D...
Vyrai kviečiami nemokamai išsitirti dėl prostatos vėžio
Ligonių kasos ragina vyrus pasirūpinti savo sveikata ir aktyviau dalyvauti Privalomojo sveikatos draudimo fondo (PSDF) l...
DIENOS KLAUSIMAS
Kaip vertinate įsigaliojusius apribojimus galimybių paso neturintiems žmonėms?
Gerai
Taip neturėtų būti!
Neturiu nuomonės
RENGINIŲ KALENDORIUS
Konferencija „Vienykimės, kad sergančiųjų retomis ligomis balsas būtų išgirstas“

Lietuvos sveikatos mokslų universiteto ligoninės Kauno klinikų Retų ligų koordinacinis centras ir LSMU Neurologijos klin

Dalyvaukime programoje „Mano širdis – mano gyvenimas“

Kas antras Lietuvos gyventojas miršta nuo širdies ir kraujagyslių ligų. Dauguma jų, deja, palieka š

Anesteziologų-reanimatologų draugijos konferencija

2016 m. vasario  26 d. 12 val. Vilniuje, “Karolinos” viešbutyje, Didžiojoje konferencijų salėje,

Pripažinti užsienio ekspertai pristatys autizmo sutrikimą turinčių vaikų ugdymo būdus

Balandžio 2 d. pasauliui minint Tarptautinę Autizmo dieną, asociacija „Kitoks vaikas” organizuoja mokslinę &

Mokslinė-praktinė konferencija „Peties ultragarsinė diagnostika“

Kviečiame dalyvauti Raumenų ir skeleto ultragarsinės diagnostikos draugijos, LSMU, LSMUL Radiologijos klinikos organizuo

Konferencija „Ribos ir šešėliai patologijoje: nenavikinė ir navikus imituojanti patologija"

Kviečiame į Vilniaus universiteto bei Lietuvos patologų draugijos organizuojamą konferenciją „Ribos ir &scaron

Milijardinė sveikatos technologijų industrija laukia inovatyvių lietuvių

Pasaulinė medicinos technologijų industrija šiandien verta apytikriai 340 milijardų JAV dolerių. Europos Sąjunga

Konferencija „Nerimo ir su stresu susiję psichikos sutrikimai: nuo diagnostinių iššūkių iki įrodymais pagrįsto gydymo“

Kviečiame dalyvauti Lietuvos sveikatos mokslų universiteto Medicinos akademijos Psichiatrijos klinikos ir Lietuvos b

Konferencija "Rinktiniai akušerijos ir ginekologijos klausimai"

Kviečiame į Lietuvos sveikatos mokslų universiteto, Lietuvos sveikatos mokslų universiteto ligoninės Akušerijos i

Gyvensenos medicina: raktas į lėtinių neinfekcinių ligų valdymą

Besidominčius sveikos gyvensenos skatinimo ir rizikos veiksnių korekcijos galimybėmis, maloniai kviečiame registruo

Gyvo maisto konferencija visuomenei ir tarptautinė mokslinė – specialistams

Ann Wigmore fondas pristato antrąją Gyvensenos medicinos konferenciją, kuri vyks 2016 m. kovo 18 d. Kauno klinikose ir k

„Žemės valandoje“ dalyvaus daugiau nei 40 savivaldybių

Kovo 19 d. nuo 20 val. 30 min. vietos laiku milijonai žmonių visame pasaulyje prisijungs prie pilietinės iniciatyvos &bd

Gyvo maisto konferencija visuomenei ir tarptautinė mokslinė – specialistams

Ann Wigmore fondas pristato antrąją Gyvensenos medicinos konferenciją, kuri vyks 2016 m. kovo 18 d. Kauno klinikose ir k

Konferencija „Endokrininė hipertenzija“

Kviečiame į LSMU, LSMUL Endokrinologijos klinikos, Endokrinologijos instituto, Lietuvos endokrinologų draugijos bei Kaun

Konferencija "Ultragarsinė diagnostika 2016"

Kviečiame dalyvauti Lietuvos ultragarso asociacijos organizuojamoje tarptautinėje mokslinėje - praktinėje konferencijoje

Konferencija „Teismo psichiatrijos ir teismo psichologijos aktualijos 2016“

Kviečiame į Valstybinės teismo psichiatrijos tarnybos prie Sveikatos apsaugos ministerijos organizuojamą tarptautinę mok

Medikų poezijos šventė „Tos birželio purpurinės rasos“

Gerbiami medikai, Jūs gydote ne tik kūnus, bet ir sielas. Talentas duodamas tam, kad pasaulį užpildytų gėrio ir grožio &

Konferencija „Lėtinės ligos ir būklės: kontracepcijos vartojimo rekomendacijos“.

Kviečiame dalyvauti Lietuvos kontraceptologijos draugijos, LSMU Akušerijos ir ginekologijos klinikos, LSMU Endokr

Konferencija "Vėlyvojo laikotarpio po organų transplantacijos problemos"

Kviečiame į Vilniaus universiteto, Lietuvos transplantologų asociacijos, Lietuvos nefrologijos, dializės ir transplantac

Trečiasis plaučių ligų kongresas

Kviečiame dalyvauti Vilniaus universiteto Medicinos fakulteto ir Lietuvos pulmonologų draugijos organizuojamame Treč

Jaunieji gydytojai kviečia diskutuoti apie sveikatos sistemos problemas

Kaip nacionalinėje sveikatos apsaugos sistemoje išgyvendinti korupciją, sustabdyti jaunų gydytojų emigraciją ir a

Konferencija „Psichikos sveikatos priežiūros paslaugų raida Lietuvoje“

Respublikinės Šiaulių ligoninės Psichiatrijos klinikos I aukšte balandžio 8 d. 9.30 val. bus atidengtos at

Vilniuje - sveikatos ir širdies stiprinimo programa

Mes visi žinome kaip svarbu sveikai maitintis, sportuoti, rūpintis savo kūnu. Deja, dažniausiai, nors visa tai ir žinome

Mokymai „Ultragarsu kontroliuojamos skydliaukės mazgų biopsijos"

Kviečiame dalyvauti Lietuvos ultragarso asociacijos organizuojamuose mokymuose „Ultragarsu kontroliuojamos skydlia

Mokymai "Ūmių būklių ultragarsinė diagnostika ir intervencinės procedūros ultragarso kontrolėje"

Kviečiame dalyvauti Lietuvos ultragarso asociacijos organizuojamuose mokymuose "Ūmių būklių ultragarsinė diagnostik

Prasideda paskaitų ciklas “Burnos sveikata ir negalia”

Vilniaus visuomenės sveikatos biuras, siekdamas pagelbėti šeimoms, auginančioms neįgalius vaikučius, organizuoja

Vilniuje– nemokami ir anonimiški greitieji ŽIV tyrimai

Asociacija „Demetra“ gegužės 14-ąją prie Baltojo tilto Vilniuje nemokamai ir anonimiškai tirs dėl ŽIV

Balandžio 30 d. Palangoje – sveikatinimo renginys „Pasirūpink ir savo sveikata“

Lietuvos sveikatos mokslų universitetas, Elgesio medicinos institutas kviečia dalyvauti 10-ajame sveikatinimo renginyje

Kviečiame mamytes ir tėvelius apsilankyti „Šeimų mokyklėlėje“

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Socialinė akcija „Neleisk, kad tymai sugriautų tavo planus!“

„Neleisk, kad tymai sugriautų tavo planus. Junkis prie akcijos ir tu“, - skelbia Užkrečiamųjų ligų ir AIDS c

Konferencija apie autologinę kraujodaros kamieninių ląstelių transplantaciją

Kviečiame į Lietuvos sveikatos mokslų universiteto medicinos akademijos Onkologijos instituto, Onkologijos ir hematologi

Atviros paskaitos apie emocinę sveikatą

Balandžio mėnesį startavo Vilniaus visuomenės sveikatos biuro organizuojamas atvirų paskaitų ciklas apie emocinę sveikat

Prasideda paskaitų ciklas apie emocinę sveikatą

Visuomenėje yra įprasta manyti, kad sveikata yra gera savijauta, kai niekuo nesergame ir nesiskundžiame, valgome sveiką

Atviros paskaitos apie emocinę sveikatą

Balandžio mėnesį startavo Vilniaus visuomenės sveikatos biuro organizuojamas atvirų paskaitų ciklas apie emocinę sveikat

Kraujo dieną – gydymo inovacijos ir dėmesys pacientų gyvenimo kokybei

Onkohematologinius ligonius vienijanti bendrija „Kraujas“ gegužės mėnesį jau ketvirtą kartą kviečia minėti K

Atviros paskaitos apie emocinę sveikatą

Balandžio mėnesį startavo Vilniaus visuomenės sveikatos biuro organizuojamas atvirų paskaitų ciklas apie emocinę sveikat

Nebėk vienas, bėk kartu su "Bėgimo akademija"

Bėgimas – viena iš populiariausių sporto šakų visame pasaulyje, kuria gali užsiimti visi norintys. T

Nebėk vienas, bėk kartu su "Bėgimo akademija"

Bėgimas – viena iš populiariausių sporto šakų visame pasaulyje, kuria gali užsiimti visi norintys. T

Nebėk vienas, bėk kartu su "Bėgimo akademija"

Bėgimas – viena iš populiariausių sporto šakų visame pasaulyje, kuria gali užsiimti visi norintys. T

Antroji jungtinė kardiologų konferencija – Šiauliuose

Birželio 1 d. 14 val. Šiauliuose, Chaimo Frenkelio viloje (Vilniaus g. 74), prasideda 2-oji jungtinė LSMU Kardiol

Sveikatingumo festivalis „Mandala“

Liepos 22-24 dienomis (nuo 17.30 val. penktadienį iki 19 val. sekmadienį) kviečiame į šeštą kartą jau orga

Onkologiniams ligoniukams ir jų draugams - šventė „Menas gydo“

Liepos 13 d. Kauno Pažaislio vienuolyno prieigose įsikūręs svetingumo kompleksas „Monte Pacis“ antrus metus

Kurorto gyventojams ir svečiams - mankštos

Lietuvos sveikatos mokslų universiteto Elgesio medicinos institutas palangiškius ir kurorto svečius kviečia į ryt

Kurorto gyventojams ir svečiams - mankštos

Lietuvos sveikatos mokslų universiteto Elgesio medicinos institutas palangiškius ir kurorto svečius kviečia į ryt

Kurorto gyventojams ir svečiams - mankštos

Lietuvos sveikatos mokslų universiteto Elgesio medicinos institutas palangiškius ir kurorto svečius kviečia į ryt

Kurorto gyventojams ir svečiams - mankštos

Lietuvos sveikatos mokslų universiteto Elgesio medicinos institutas palangiškius ir kurorto svečius kviečia į ryt

Konferencija “Ultragarsinės diagnostikos vasaros mokykla: teorija ir praktika 2016"

Lietuvos ultragarso asociacija kviečia dalyvauti tarptautinėje mokslinėje - praktinėje konferencijoje “Ultragarsin

Sporto ir menų šventėje – atviras žvilgsnis į psichiatriją

Respublikinės Šiaulių ligoninės Psichiatrijos klinikoje (M.K. Čiurlionio g. 12) liepos 15 d. nuo 11.00 val. vyks

Nemokama psichologinė pagalba sergantiesiems onkologinėmis ligomis ir jų artimiesiems

VšĮ Ligos paliestųjų psichologinės pagalbos centras kartu su Kauno klinikomis vykdo projektą „Psichinės sve

Vilniuje mamytėms ir tėveliams - „Šeimų mokyklėlė“

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Vilniuje mamytėms ir tėveliams - „Šeimų mokyklėlė“

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Vilniuje mamytėms ir tėveliams - „Šeimų mokyklėlė“

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Sveikatos stiprinimo programa „Mano širdis - mano gyvenimas"

Vilniaus visuomenės sveikatos biuras kviečia dalyvauti Širdies ir kraujagyslių ligų ir cukrinio diabeto rizikos g

Vilniuje mamytėms ir tėveliams - „Šeimų mokyklėlė“

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Sveikatos stiprinimo programa „Mano širdis - mano gyvenimas"

Vilniaus visuomenės sveikatos biuras kviečia dalyvauti Širdies ir kraujagyslių ligų ir cukrinio diabeto rizikos g

Vilniuje mamytėms ir tėveliams - „Šeimų mokyklėlė“

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Startuoja tėvystės įgūdžių lavinimo programa „Tėvų grupė"

Vilniaus visuomenės sveikatos biuras kviečia mamas ir (ar) tėčius, auginančius įvairaus amžiaus vaikus registruotis į &b

Klaipėdoje vyks Tarptautinės Judriosios savaitės minėjimas

Europoje kiekvienais metais rugsėjo 16-22 d. minima Judrioji savaitė, kurios metu rengiami įvairūs renginiai ir akcijos.

Vilniuje mamytėms ir tėveliams - „Šeimų mokyklėlė“

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Panevėžyje - nemokami sveikatos biuro renginiai

Panevėžio miesto savivaldybės Visuomenės sveikatos biuras kviečia į nemokamus rugsėjo mėnesį vyksiančius renginius.

Pasaulinei širdies dienai – visuomenės diskusija su prof. R. Benečiu

Lietuvos širdies asociacija ir Respublikinės Šiaulių ligoninės Širdies ir kraujagyslių centras rugs

Vilniuje mamytėms ir tėveliams - „Šeimų mokyklėlė“

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Sveikatos stiprinimo programa „Mano širdis - mano gyvenimas"

Vilniaus visuomenės sveikatos biuras kviečia dalyvauti Širdies ir kraujagyslių ligų ir cukrinio diabeto rizikos g

Vilniuje - nemokama sveikatos stiprinimo programa

Visuomenės sveikatos specialistai akcentuoja, jog kraujotakos sistemos ligas daužniausiai sukelia rizikos veiksniai, kur

Vilniuje mamytėms ir tėveliams - „Šeimų mokyklėlė“

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Vilniuje mamytėms ir tėveliams - „Šeimų mokyklėlė“

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Sveikatos stiprinimo programa „Mano širdis - mano gyvenimas"

Vilniaus visuomenės sveikatos biuras kviečia dalyvauti Širdies ir kraujagyslių ligų ir cukrinio diabeto rizikos g

„Jogos dienos 2016“ – natūralus sveikatos palaikymas taupo mūsų laiką ir pinigus

Trečią kartą Kaune ir antrą – Vilniuje vyks natūralios sveikatos ir jogos festivalis – „Jogos dienos 2

„Jogos dienos 2016“ – natūralus sveikatos palaikymas taupo mūsų laiką ir pinigus

Trečią kartą Kaune ir antrą – Vilniuje vyks natūralios sveikatos ir jogos festivalis – „Jogos dienos 2

Startuoja tėvystės įgūdžių lavinimo programa „Tėvų grupė"

Vilniaus visuomenės sveikatos biuras kviečia mamas ir (ar) tėčius, auginančius įvairaus amžiaus vaikus registruotis į &b

Startuoja tėvystės įgūdžių lavinimo programa „Tėvų grupė"

Vilniaus visuomenės sveikatos biuras kviečia mamas ir (ar) tėčius, auginančius įvairaus amžiaus vaikus registruotis į &b

Panevėžyje - nemokami sveikatos biuro renginiai

Panevėžio miesto savivaldybės Visuomenės sveikatos biuras kviečia į nemokamus rugsėjo mėnesį vyksiančius renginius.

Psichiatrijos klinikoje – atviros psichiatrijos mėnuo

Atviros psichiatrijos mėnuo – tai laikotarpis tarp dviejų svarbių psichikos sveikatai tarptautinių dienų – P

Klaipėdoje vyks Tarptautinės Judriosios savaitės minėjimas

Europoje kiekvienais metais rugsėjo 16-22 d. minima Judrioji savaitė, kurios metu rengiami įvairūs renginiai ir akcijos.

Panevėžyje - nemokami sveikatos biuro renginiai

Panevėžio miesto savivaldybės Visuomenės sveikatos biuras kviečia į nemokamus rugsėjo mėnesį vyksiančius renginius.

Panevėžyje - nemokami sveikatos biuro renginiai

Panevėžio miesto savivaldybės Visuomenės sveikatos biuras kviečia į nemokamus rugsėjo mėnesį vyksiančius renginius.

Panevėžyje - nemokami sveikatos biuro renginiai

Panevėžio miesto savivaldybės Visuomenės sveikatos biuras kviečia į nemokamus rugsėjo mėnesį vyksiančius renginius.

Panevėžyje - nemokami sveikatos biuro renginiai

Panevėžio miesto savivaldybės Visuomenės sveikatos biuras kviečia į nemokamus rugsėjo mėnesį vyksiančius renginius.

Panevėžyje - nemokami sveikatos biuro renginiai

Panevėžio miesto savivaldybės Visuomenės sveikatos biuras kviečia į nemokamus rugsėjo mėnesį vyksiančius renginius.

Panevėžyje - nemokami sveikatos biuro renginiai

Panevėžio miesto savivaldybės Visuomenės sveikatos biuras kviečia į nemokamus rugsėjo mėnesį vyksiančius renginius.

Panevėžyje - nemokami sveikatos biuro renginiai

Panevėžio miesto savivaldybės Visuomenės sveikatos biuras kviečia į nemokamus rugsėjo mėnesį vyksiančius renginius.

Socialinis-meninis projektas „Praliek kraujo“

Lietuvos dailininkų sąjunga ir Nacionalinis kraujo centras kviečia dalyvauti socialiniame-meniniame projekte „pral

Socialinis-meninis projektas „Praliek kraujo“

Lietuvos dailininkų sąjunga ir Nacionalinis kraujo centras kviečia dalyvauti socialiniame-meniniame projekte „pral

Socialinis-meninis projektas „Praliek kraujo“

Lietuvos dailininkų sąjunga ir Nacionalinis kraujo centras kviečia dalyvauti socialiniame-meniniame projekte „pral

Kviečia moteris nemokamai išsitirti dubens dugno raumenų funkciją

Gruodis – tai laikotarpis, kai norisi kuo daugiau padaryti dėl savo artimųjų, tačiau neturėtumėte pamiršti

Psichiatrijos klinikoje – atviros psichiatrijos mėnuo

Atviros psichiatrijos mėnuo – tai laikotarpis tarp dviejų svarbių psichikos sveikatai tarptautinių dienų – P

Klaipėdoje vyks Tarptautinės Judriosios savaitės minėjimas

Europoje kiekvienais metais rugsėjo 16-22 d. minima Judrioji savaitė, kurios metu rengiami įvairūs renginiai ir akcijos.

Klaipėdoje vyks Tarptautinės Judriosios savaitės minėjimas

Europoje kiekvienais metais rugsėjo 16-22 d. minima Judrioji savaitė, kurios metu rengiami įvairūs renginiai ir akcijos.

Vilniuje - nemokama sveikatos stiprinimo programa

Visuomenės sveikatos specialistai akcentuoja, jog kraujotakos sistemos ligas daužniausiai sukelia rizikos veiksniai, kur

Vilniuje - nemokama sveikatos stiprinimo programa

Visuomenės sveikatos specialistai akcentuoja, jog kraujotakos sistemos ligas daužniausiai sukelia rizikos veiksniai, kur

Infekcinių ligų aktualijos

Kviečiame dalyvauti Lietuvos sveikatos mokslų universiteto Infekcinių ligų klinikos ir Lietuvos infektologų draugijos or

Mokymai “Bronchinės astmos diagnostikos ir gydymo praktiniai aspektai”

Kviečiame dalyvauti Lietuvos pulmonologų draugijos organizuojamuose mokymuose “Bronchinės astmos diagnostikos ir g

To dar nebuvo: kartu siekime donoro kortelių pasirašymo rekordo!

Spalio 8-ąją bus minima Organų donorystės diena ir šiai dienai paminėti pirmą kartą Lietuvoje organizuojama sutik

Tarptautinis rudens bėgimas – už organų donorystės idėją

„Aš bėgu už organų donorystę“ – toks užrašas puoš kiekvieno bėgiko, dalyvausianči

Mokymai “Bronchinės astmos diagnostikos ir gydymo praktiniai aspektai”

Kviečiame dalyvauti Lietuvos pulmonologų draugijos organizuojamuose mokymuose “Bronchinės astmos diagnostikos ir g

Muzikos terapijos užsiėmimai būsimoms mamoms

Nustatyta, kad penkių mėnesių žmogaus vaisius jau skiria aplinkos garsus. Mamos balsas, širdies plakimas, kvėpavi

Pasaulinės žvynelinės dienos minėjimas Kaune

Spalio 29-oji – Pasaulinė žvynelinės diena. Jos paskelbimo iniciatorius yra Tarptautinė žvynelinės draugijų federa

41 dieną trukęs „Širdies žygis“ finišuoja

41 diena, 1300 kilometrų ir daugiau kaip 20 tūkst. eurų vėžiu sergantiems vaikams. Toks yra „1000 km Širdie

Vilniaus išsėtinės sklerozės draugija kviečia į renginį

Spalio 26 d. 18 val. Salotų bare “Mano guru” (Vilniaus g. 22/1, Vilnius) vyks dailininko Simo Skrabulio darb

Klaipėdoje - nemokami seminarai su onkologine liga susidūrusiems žmonėms

Onkohematologinių ligonių bendrija „Kraujas“ organizuoja ir kviečia onkologinės ligos patirtį turinčius žmon

Klaipėdoje - nemokami seminarai su onkologine liga susidūrusiems žmonėms

Onkohematologinių ligonių bendrija „Kraujas“ organizuoja ir kviečia onkologinės ligos patirtį turinčius žmon

Žvakutės, skirtos 1410 organų donorų, suliepsnos 9 miestuose

Lietuvos asociacija „Gyvastis“ spalio 25-ąją, antradienį, jau trečią kartą inicijuoja akciją, skirtą spalio

Padėkos renginys gyviesiems organų donorams ir gydytojams reanimatologams

Lietuvos asociacija „Gyvastis“ 2016 metų spalio 25-ąją, antradienį, organizuoja Padėkos renginį, skirtą padė

Apie sezoninę depresiją paskaitoje-diskusijoje „Melancholija ar ruduo?“

Atėjus rudens sezonui dažnas žmogus mini rudeninę depresiją, mintyse turėdamas prislėgtumo jausmą, kuris aplanko tamsesn

Muzikos terapijos užsiėmimai būsimoms mamoms

Nustatyta, kad penkių mėnesių žmogaus vaisius jau skiria aplinkos garsus. Mamos balsas, širdies plakimas, kvėpavi

Muzikos terapijos užsiėmimai būsimoms mamoms

Nustatyta, kad penkių mėnesių žmogaus vaisius jau skiria aplinkos garsus. Mamos balsas, širdies plakimas, kvėpavi

Renginys, skirtas Europos sveikos mitybos dienai

Vilniaus visuomenės sveikatos biuras kviečia darbingo amžiaus žmones paminėti Europos sveikos mitybos dieną kartu. Lapkr

Konferencija, skirta Klaipėdos ligoninių inovacijoms

Lapkričio 17 dieną 16 valandą Kultūros fabrike (Bangų gatvė 5A) vyks konferencija, skirta Klaipėdos ligoninių inovacijom

Šiauliuose – konferencija „Pulmonologijos naujienos“

Kviečiame dalyvauti mokslinėje – praktinėje konferencijoje „Pulmonologijos naujienos“, kuri vyks 2016

Raumenų ir skeleto ultragarsinės diagnostikos seminaras

Poilsio ir sveikatingumo komplekso „Atostogų parkas“ konferencijų salėje „Palanga“ (Venecijos ak

Raumenų ir skeleto ultragarsinės diagnostikos seminaras

Poilsio ir sveikatingumo komplekso „Atostogų parkas“ konferencijų salėje „Palanga“ (Venecijos ak

Lėtinės obstrukcinės plaučių ligos aktualijos

Kviečiame dalyvauti mokymuose „Lėtinės obstrukcinės plaučių ligos aktualijos“, kurie vyks š. m. gruod

Šiaulių krašto akušerių konferencija

Respublikinės Šiaulių ligoninės Chirurgijos korpuso (V. Kudirkos g. 99C) didžiojoje salėje gruodžio 9 d. 10.00 va

Kviečia moteris nemokamai išsitirti dubens dugno raumenų funkciją

Gruodis – tai laikotarpis, kai norisi kuo daugiau padaryti dėl savo artimųjų, tačiau neturėtumėte pamiršti

Gydytoja ginekologė – apie merginų fiziologiją ir higieną

Niekas nesiginčys – geros sveikatos siekia kiekvienas. Todėl Antakalnio poliklinika kviečia į nemokamą paskaitą ap

„Naujas ir moksliškai pagrįstas požiūris į kasdienę klinikinę praktiką akušerijoje ir ginekologijoje“

Kviečiame į mokslinę konferenciją „Naujas ir moksliškai pagrįstas požiūris į kasdienę klinikinę praktiką ak

Po blaivių Naujųjų metų – šuolis į ledinę eketę

Kiekvienų metų sausio 1-ąjądieną visi pasaulio "ruoniai" rengia simbolinį susitikimą vandenyje. Kiekvienas ats

Vilniuje startuoja tėvystės įgūdžių lavinimo programa

Vilniaus visuomenės sveikatos biuras kviečia mamas ir (ar) tėčius, auginančius įvairaus amžiaus vaikus registruotis į TĖ

Vilniuje startuoja tėvystės įgūdžių lavinimo programa

Vilniaus visuomenės sveikatos biuras kviečia mamas ir (ar) tėčius, auginančius įvairaus amžiaus vaikus registruotis į TĖ

Vilniuje startuoja tėvystės įgūdžių lavinimo programa

Vilniaus visuomenės sveikatos biuras kviečia mamas ir (ar) tėčius, auginančius įvairaus amžiaus vaikus registruotis į TĖ

Jaunieji gydytojai kviečia į „TransForm 2.0“

Galingiausias jaunųjų gydytojų renginys grįžta:šių metų vasario 3-5 dienomis Birštone vyks įspūdingas jaun

Kviečia į nemokamas relaksacijų pratybas Vilniuje

Vilniaus visuomenės sveikatos biuras kviečia visus norinčius sumažinti psichinę bei fizinę įtampą į relaksacijų pratybas

Kviečia į nemokamas relaksacijų pratybas Vilniuje

Vilniaus visuomenės sveikatos biuras kviečia visus norinčius sumažinti psichinę bei fizinę įtampą į relaksacijų pratybas

Kviečia į nemokamas relaksacijų pratybas Vilniuje

Vilniaus visuomenės sveikatos biuras kviečia visus norinčius sumažinti psichinę bei fizinę įtampą į relaksacijų pratybas

„Naujieji iššūkiai intensyvioje terapijoje ir skubioje medicinoje“.

Lietuvos intensyviosios kardiologijos ir skubiosios medicinos asociacija organizuoja tarptautinę mokslinę praktinę konfe

Kviečia į nemokamas relaksacijų pratybas Vilniuje

Vilniaus visuomenės sveikatos biuras kviečia visus norinčius sumažinti psichinę bei fizinę įtampą į relaksacijų pratybas

Kaune - 9-oji sveikatingumo, sveikos gyvensenos ir medicinos paroda „Sveikatos dienos“

2017 m. vasario 24–26 dienomis Aukštaičių g. 51, Kaune vyks 9-oji sveikatingumo, sveikos gyvensenos ir medi

Konferencija, skirta Tarptautinei retų ligų dienai

Maloniai kviečiame dalyvauti Tarptautinei retų ligų dienai skirtoje konferencijoje „Mokslo pažanga – viltis

„Apsinuodijimų ir infekcinių susirgimų sąlyčio taškai“

Lietuvos infektologų draugija, Lietuvos klinikinės toksikologijos draugija, Sveikatos apsaugos ministerijos ESSC apsinuo

Kviečia į nemokamas paskaitas „Šeimų mokyklėlėje“ Vilniuje

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Kviečia į nemokamas paskaitas „Šeimų mokyklėlėje“ Vilniuje

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Kviečia į nemokamas paskaitas „Šeimų mokyklėlėje“ Vilniuje

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Kviečia į nemokamas paskaitas „Šeimų mokyklėlėje“ Vilniuje

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Kviečia į nemokamas paskaitas „Šeimų mokyklėlėje“ Vilniuje

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Kviečia į nemokamas paskaitas „Šeimų mokyklėlėje“ Vilniuje

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Kviečia į nemokamas paskaitas „Šeimų mokyklėlėje“ Vilniuje

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Kviečia į nemokamas paskaitas „Šeimų mokyklėlėje“ Vilniuje

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Kviečia į nemokamas paskaitas „Šeimų mokyklėlėje“ Vilniuje

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Kviečia į nemokamas paskaitas „Šeimų mokyklėlėje“ Vilniuje

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Kviečia į nemokamas paskaitas „Šeimų mokyklėlėje“ Vilniuje

Vilniaus visuomenės sveikatos biuras vykdo programą, skirtą nėščiųjų ir pagimdžiusių moterų švietimui bei

Sergantiems širdies nepakankamumu – nemokamas edukacinis renginys

Širdies nepakankamumas – plačiai paplitęs ir brangiai kainuojantis susirgimas, reiškiantis didžiulę

„Sveikata 2017“ - paroda net ir sveikiausiems

Pavasaris – metas tapti sveikesniais. Kaip tai padaryti, sužinosite atvykę į Klaipėdą, kovo 17-19 dienomis „

Konferencija „Psichologas organizacijoje. Kuo vertinga darbuotojų įvairovė?“

Balandžio 21 d. vyks kasmetinė, jau VII organizacinės psichologijos konferencija „Psichologas organizacijoje. Kuo

Fizinės veiklos nauda onkologiniams pacientams: geresnė savijauta ir mažesnis nuovargis

Onkohematologinių ligonių bendrija „Kraujas“ nuo gegužės mėnesio žmones, turinčius onkologinės ligos patirtį

Fizinės veiklos nauda onkologiniams pacientams: geresnė savijauta ir mažesnis nuovargis

Onkohematologinių ligonių bendrija „Kraujas“ nuo gegužės mėnesio žmones, turinčius onkologinės ligos patirtį

Vilniečiams – paskaita apie priklausomybę nuo interneto, žaidimų, darbo

Apie ką pirmiausia pagalvojate išgirdę žodį „priklausomybė“?Kokia yra riba tarp įpročių, eksperimenta

Fizinės veiklos nauda onkologiniams pacientams: geresnė savijauta ir mažesnis nuovargis

Onkohematologinių ligonių bendrija „Kraujas“ nuo gegužės mėnesio žmones, turinčius onkologinės ligos patirtį

Fizinės veiklos nauda onkologiniams pacientams: geresnė savijauta ir mažesnis nuovargis

Onkohematologinių ligonių bendrija „Kraujas“ nuo gegužės mėnesio žmones, turinčius onkologinės ligos patirtį

Klaipėdoje - projekto ir knygos „Kiekviena diena brangi“ pristatymo renginys

Gegužės 31 d. 16.00 val. Šv. Pranciškaus onkologijos centre (Savanorių g. 4, Klaipėda) vyks projekto ir kn

Sporto varžybos „Saugus poilsis“

Klaipėdos miesto visuomenės sveikatos biuro specialistai drauge su UAB „Vakarų pramogos“, BĮ „Klaipėdo

Vilniečiai ir kauniečiai kviečiami tikrintis dėl širdies nepakankamumo

Šia liga susirgti gali 1 iš 5 vyresnių nei 40 metų amžiaus žmonių. Pasaulyje nuo jos kenčia maždaug 26 mil

Dermatologai kviečia pasitikrinti savo odą

Tik 14 proc. europiečių laikosi saulės apsaugos patarimų, nors 91 proc. žino apie gresiantį pavojų.  Pristatoma sąm

Vilniečiai ir kauniečiai kviečiami tikrintis dėl širdies nepakankamumo

Šia liga susirgti gali 1 iš 5 vyresnių nei 40 metų amžiaus žmonių. Pasaulyje nuo jos kenčia maždaug 26 mil

Vilniečiai ir kauniečiai kviečiami tikrintis dėl širdies nepakankamumo

Šia liga susirgti gali 1 iš 5 vyresnių nei 40 metų amžiaus žmonių. Pasaulyje nuo jos kenčia maždaug 26 mil

Nemokamų treniruočių projektas „Judėk sveikai“ pradeda vasaros sezoną

Daugelio kauniečių jau puikiai atpažįstamas ir laukiamas nemokamų treniruočių projektas „Judėk sveikai“ nusp

Bėgimas vėl kviečia burtis Vilties mieste

Gegužės 21 dieną Klaipėdoje startuos tradicinis jubiliejinis – šiemet dešimtasis – Vilties bėg

Neuromenas: nauja meno ir mokslo šaka pirmą kartą pristatoma Lietuvoje

Aktyvus gyvenimo būdas, sveika mityba, poilsis – geros fizinės sveikatos receptą žino kiekvienas. Tačiau Lietuvoje

Dešimtą kartą dailės studentai pristatys kolekciją onkologinėms pacientėms

Nacionalinio vėžio instituto Didžiojoje salėje birželio 7 d. 14 val. Vilniaus dailės akademijos (VDA) Kostiumo dizaino k

Viso pasaulio profesionalai susitelkia į vaikų ir paauglių ginekologijos problemas

2017 m. birželio mėn. 7-10 d. Vilniuje vyks 14-asis Europos vaikų ir paauglių ginekologijos kongresas EURAPAG 2017.

Ypatinga paroda kvies klaipėdiečius atrasti neišnešiotų kūdikių genialumą

Trečiadienį, birželio 14 d., 17:30 val. Klaipėdos prekybos centre „Akropolis“ bus iškilmingai atidaro

Norite būti laimingesni? Jus kviečia festivalis „Mandala“

Kviečiame trims dienoms pabėgti nuo miesto šurmulio ir pailsėti, atgauti jėgas, pasikrauti teigiamos energijos la

Tarptautinė jogos diena – kas laukia šių metų renginyje?

Trečius metus iš eilės Lietuvoje, kaip visame pasaulyje, bus minima Tarptautinė jogos diena. Birželio 21-ąją nuo

Kviečia į susitikimą su prekės ženklo „Julia Janus“ įkūrėja

Šv. Pranciškaus onkologijos centras (Savanorių g. 4, Klaipėda) 2017 m. birželio 26 d., 13.00 val., pirmadi

Vilniečiams – nemokamos jogos pamokos miesto parkuose

„Sveikas miestas“ kviečia sostinės gyventojus vasarą lankyti atvirus jogos užsiėmimus Vingio parke ir Bernar

Sostinėje rugpjūtį – atviros sąmoningo kvėpavimo praktikos parkuose

Vilniečiai kviečiami dalyvauti iniciatyvoje „Kvėpuok laisvai, gyvenk laimingai”, kurios metu visi norintys g

Sostinėje rugpjūtį – atviros sąmoningo kvėpavimo praktikos parkuose

Vilniečiai kviečiami dalyvauti iniciatyvoje „Kvėpuok laisvai, gyvenk laimingai”, kurios metu visi norintys g

Sostinėje rugpjūtį – atviros sąmoningo kvėpavimo praktikos parkuose

Vilniečiai kviečiami dalyvauti iniciatyvoje „Kvėpuok laisvai, gyvenk laimingai”, kurios metu visi norintys g

Sostinėje rugpjūtį – atviros sąmoningo kvėpavimo praktikos parkuose

Vilniečiai kviečiami dalyvauti iniciatyvoje „Kvėpuok laisvai, gyvenk laimingai”, kurios metu visi norintys g

Kraujo ligų žinomumo dienos prasidės konferencija „Kraujo diena“

Rugsėjo mėnesį visame pasaulyje yra minimos piktybinių kraujo ligų žinomumo dienos, kurių tikslas – kuo plačiau sk

Žydrūnas Savickas susitiks su sergančiasiais išsėtine skleroze

Rugsėjo 2 d. 13 valandą Savicko sporto klube („SEB arena, II aukštas) vyks seminaras „Kaip fizinis ak

Paroda „Pirmoji širdies transplantacija Lietuvoje Petro Katauskio fotografijose“

Rugsėjo 13 d., trečiadienį, 16 val. Lietuvos medicinos bibliotekoje (Kaštonų g. 7, Vilnius) atidaroma paroda &bdq

Nauja iniciatyva Kaune – „Tu nesi vienas“

Keblios situacijos, stresas ir kiti kasdienę rutiną temdantys rūpesčiai – ne priežastis pulti į neviltį. Kiekvienu

Trečiasis Jaunųjų gydytojų asociacijos forumas "TransForm"

Trečiasis Jaunųjų gydytojų asociacijos (JGA) forumas TransForm - jau spalio 13 - 15 d.! Čia nuoširdžia

Performansas „Mirštu, kaip noriu gyventi“ klausia, kiek lauktum dėl kito gyvybės

„Gyvenimas sulėtėja, tarsi sapne“. „Eiti negali, bėgti negali, valgyti negali“. „Sėdi ir l

Kviečia į nemokamą seminarą „Kas sukelia nugaros skausmą ir kaip jo išvengti?“

Vilniaus miesto visuomenės sveikatos biuras prisijungdamas prie Europos judriosios savaitės iniciatyvos kviečia į nemoka

Sieks didžiausio iš žmonių sudaryto širdies ženklo rekordo

Minėdamas Pasaulinę širdies dieną Panevėžio miesto savivaldybės visuomenės sveikatos biuras kviečia visus panevėž

Jubiliejinė konferencija „Atverkime akis realybei, kurioje yra smurtas“

Lietuvos emocinės paramos tarnybų asociacija (LEPTA) yra nevyriausybinė organizacija, vienijanti Lietuvoje veikiančias t

Atviros psichiatrijos mėnesio renginiai Šiaulių P. Višinskio bibliotekoje

Respublikinės Šiaulių ligoninės Psichiatrijos klinikos rengiamas Atviros psichiatrijos mėnuo miesto gyventojus kv

Tarptautinę pagyvenusių žmonių dieną švęskime kartu

Vilniaus visuomenės sveikatos biuras kviečia visus vyresnio amžiaus žmones kartu paminėti Tarptautinę pagyvenusių žmonių

Fotografijų paroda „Apsaugokime mūsų ateitį: meningokokinę infekciją išgyvenusių asmenų portretai“

„Apsaugokime mūsų ateitį: meningokokinę infekciją išgyvenusių asmenų portretai“ – subtili, jaut

Fotografijų paroda „Apsaugokime mūsų ateitį: meningokokinę infekciją išgyvenusių asmenų portretai“

„Apsaugokime mūsų ateitį: meningokokinę infekciją išgyvenusių asmenų portretai“ – subtili, jaut

Fotografijų paroda „Apsaugokime mūsų ateitį: meningokokinę infekciją išgyvenusių asmenų portretai“

„Apsaugokime mūsų ateitį: meningokokinę infekciją išgyvenusių asmenų portretai“ – subtili, jaut

Fotografijų paroda „Apsaugokime mūsų ateitį: meningokokinę infekciją išgyvenusių asmenų portretai“

„Apsaugokime mūsų ateitį: meningokokinę infekciją išgyvenusių asmenų portretai“ – subtili, jaut

Padėkos renginys donorystės ir transplantacijos proceso dalyviams

Lietuvos asociacija „Gyvastis“ 2017 metų spalio 20-ąją, penktadienį, organizuoja Padėkos renginį, skirtą pag

Dėkingumo renginiai gyviesiems donorams, mirusių donorų artimiesiems ir medikams

Organų donorai ir jų artimieji verti didžiausios pagarbos ir amžino dėkingumo. Todėl spalį, kai minima Europos ir Pasaul

100 dienų apie TAI: atvira diskusija apie lytiškumą Vilniaus jaunimui

Gera jaunimo lytinė sveikata – visuomenės, kuri siekia gyvuoti ir klestėti interesas, tai ypač svarbu mūsų &scaron

Kaip gyventi, persirgus onkologine liga: patarimai ir praktika

Respublikinės Šiaulių ligoninės Onkologijos klinikos (Darželio g. 10), Administracijos salėje (2 aukšte) s

Neišnešiotukų dienai mezgimo iniciatyva ir minėjimas

Lapkričio 17-ąją dieną minima Pasaulinė neišnešiotų naujagimių diena. Respublikinės Šiaulių ligonin

Augink barzdą – prižiūrėk savo vyriškumą

„Barzdotas lapkritis“ – mėnuo be skutimosi peiliukų. Su šūkiais „Prižiūrėk savo vyri&scar

Augink barzdą – prižiūrėk savo vyriškumą

„Barzdotas lapkritis“ – mėnuo be skutimosi peiliukų. Su šūkiais „Prižiūrėk savo vyri&scar

Augink barzdą – prižiūrėk savo vyriškumą

Vilniuje surengtas sportinio pokerio turnyras, kurio dalis surinktų lėšų skirtos sergantiesiems prostatos vėžiu r

Klaipėdoje – nemokamas renginys „Tu – mano gyvenimo herojus“

Pirmą kartą Klaipėdoje lapkričio 16 dieną vyks nemokamas renginys "Tu – mano gyvenimo herojus“, skirtas

Augink barzdą – prižiūrėk savo vyriškumą

„Barzdotas lapkritis“ – mėnuo be skutimosi peiliukų. Su šūkiais „Prižiūrėk savo vyri&scar

Augink barzdą – prižiūrėk savo vyriškumą

Vilniuje surengtas sportinio pokerio turnyras, kurio dalis surinktų lėšų skirtos sergantiesiems prostatos vėžiu r

„Ūsai bėga“ – už Lietuvos vyrus, kurie gyvena trumpiausiai Europoje

Ketvirtą kartą organizuojamas bėgimas už vyrų sveikatą „Ūsai bėga“ Vilniuje. Miesto centre įvyksiantis bėgim

Augink barzdą – prižiūrėk savo vyriškumą

„Barzdotas lapkritis“ – mėnuo be skutimosi peiliukų. Su šūkiais „Prižiūrėk savo vyri&scar

Startuoja aktyvaus laisvalaikio projektas šeimoms – pirmasis renginys jau šį savaitgalį

Vilniaus visuomenės sveikatos biuras drauge su „Sveiku miestu“ kviečia šeimas dalyvauti projekte &bdq

Startuoja aktyvaus laisvalaikio projektas šeimoms – pirmasis renginys jau šį savaitgalį

Vilniaus visuomenės sveikatos biuras drauge su „Sveiku miestu“ kviečia šeimas dalyvauti projekte &bdq

Startuoja aktyvaus laisvalaikio projektas šeimoms – pirmasis renginys jau šį savaitgalį

Vilniaus visuomenės sveikatos biuras drauge su „Sveiku miestu“ kviečia šeimas dalyvauti projekte &bdq

Startuoja aktyvaus laisvalaikio projektas šeimoms – pirmasis renginys jau šį savaitgalį

Vilniaus visuomenės sveikatos biuras drauge su „Sveiku miestu“ kviečia šeimas dalyvauti projekte &bdq

Bendraminčių sambūris: gyvų sėklų šventė „Pasėkime ateitį”

Šį savaitgalį, sausio 20-21 d., Klaipėdos r., Doviluose (Klaipėdos g. 35) vyks Dovilų krašto gyventojų ir

Bendraminčių sambūris: gyvų sėklų šventė „Pasėkime ateitį”

Šį savaitgalį, sausio 20-21 d., Klaipėdos r., Doviluose (Klaipėdos g. 35) vyks Dovilų krašto gyventojų ir

Atsinaujinusiame projekte „Judėk sveikai“ – dvigubai daugiau nemokamų treniruočių kauniečiams

Prasidėję nauji Geltonojo šuns metai nemokamų treniruočių projektui „Judėk sveikai“ atnešė dau

Vilniečiams – nauji sporto ir sveikatingumo pasiūlymai

„Sveikas miestas“ drauge su sostinėje įsikūrusiomis organizacijomis kviečia paskutinįjį žiemos mėnesį pralei

Vilniečiams – nauji sporto ir sveikatingumo pasiūlymai

„Sveikas miestas“ drauge su sostinėje įsikūrusiomis organizacijomis kviečia paskutinįjį žiemos mėnesį pralei

Vilniečiams – nauji sporto ir sveikatingumo pasiūlymai

„Sveikas miestas“ drauge su sostinėje įsikūrusiomis organizacijomis kviečia paskutinįjį žiemos mėnesį pralei

Vilniečiams – nauji sporto ir sveikatingumo pasiūlymai

„Sveikas miestas“ drauge su sostinėje įsikūrusiomis organizacijomis kviečia paskutinįjį žiemos mėnesį pralei

Vilniečiams – nauji sporto ir sveikatingumo pasiūlymai

„Sveikas miestas“ drauge su sostinėje įsikūrusiomis organizacijomis kviečia paskutinįjį žiemos mėnesį pralei

Vilniečiams – nauji sporto ir sveikatingumo pasiūlymai

„Sveikas miestas“ drauge su sostinėje įsikūrusiomis organizacijomis kviečia paskutinįjį žiemos mėnesį pralei

Vilniečiams – nauji sporto ir sveikatingumo pasiūlymai

„Sveikas miestas“ drauge su sostinėje įsikūrusiomis organizacijomis kviečia paskutinįjį žiemos mėnesį pralei

Vilniečiams – nauji sporto ir sveikatingumo pasiūlymai

„Sveikas miestas“ drauge su sostinėje įsikūrusiomis organizacijomis kviečia paskutinįjį žiemos mėnesį pralei

Vilniečiams – nauji sporto ir sveikatingumo pasiūlymai

„Sveikas miestas“ drauge su sostinėje įsikūrusiomis organizacijomis kviečia paskutinįjį žiemos mėnesį pralei

Vilniečiams – nauji sporto ir sveikatingumo pasiūlymai

„Sveikas miestas“ drauge su sostinėje įsikūrusiomis organizacijomis kviečia paskutinįjį žiemos mėnesį pralei

Šv. Pranciškaus onkologijos centre – poezijos terapijos užsiėmimai

2018 m. vasario 23 d. (penktadienį) 12.30 val. Šv. Pranciškaus onkologijos centre (Savanorių g. 4, Klaipėd

Kursime sveikatos priežiūros inovacijas. Laukia prizas

Nepraleiskite progos! Jau kovo 2 – 4 d. „Hacker Games“ kursime sveikatos priežiūros inovacijas. Sudomi

Vilniečiai kviečiami pavasarį sutikti sportiškai ir triukšmingai

„Sveikas miestas“ sostinės gyventojus bei miesto svečius kviečia šiltajam metų sezonui ruoštis

Vilniečiai kviečiami išbandyti sveikatingumo naujovę

„Sveikas miestas“, bendradarbiaudamas su „Studija Om“ bei „Studija M“, kviečia sosti

Vilniečiai kviečiami išbandyti sveikatingumo naujovę

„Sveikas miestas“, bendradarbiaudamas su „Studija Om“ bei „Studija M“, kviečia sosti

Vilniečiai kviečiami išbandyti sveikatingumo naujovę

„Sveikas miestas“, bendradarbiaudamas su „Studija Om“ bei „Studija M“, kviečia sosti

Vilniečiai kviečiami išbandyti sveikatingumo naujovę

„Sveikas miestas“, bendradarbiaudamas su „Studija Om“ bei „Studija M“, kviečia sosti

Vilniečiai kviečiami išbandyti sveikatingumo naujovę

„Sveikas miestas“, bendradarbiaudamas su „Studija Om“ bei „Studija M“, kviečia sosti

Vilniečiai kviečiami išbandyti sveikatingumo naujovę

„Sveikas miestas“, bendradarbiaudamas su „Studija Om“ bei „Studija M“, kviečia sosti

Vilniečiai kviečiami išbandyti sveikatingumo naujovę

„Sveikas miestas“, bendradarbiaudamas su „Studija Om“ bei „Studija M“, kviečia sosti

Vilniečiai kviečiami išbandyti sveikatingumo naujovę

„Sveikas miestas“, bendradarbiaudamas su „Studija Om“ bei „Studija M“, kviečia sosti

Vilniuje ir Kaune veiks atviros klinikos centrinėse miestų aikštėse

Solidarizuodamasi su visa Europa ir siekdama atkreipti visuomenės dėmesį į sekinantį ir visą gyvenimą trunkantį susirgim

Vilniuje ir Kaune veiks atviros klinikos centrinėse miestų aikštėse

Solidarizuodamasi su visa Europa ir siekdama atkreipti visuomenės dėmesį į sekinantį ir visą gyvenimą trunkantį susirgim

Kardiologų IV jungtinė konferencija – Bistrampolio dvare

Respublikinės Šiaulių ligoninės Širdies ir kraujagyslių centro specialistai drauge su Lietuvos sveikatos m

Inovatyvios širdies formulė

Spalio 4 d. 17 val. Inovatyvios medicinos draugija kviečia susitikti Gyvybės mokslų centre, pirmajame šio sezono

Atpažinti ir stebėti kraujo ligas moko tradicinė konferencija

Šeštą kartą rengiama konferencija „Kraujo ligos – kaip jas atpažinti ir stebėti“ &scaron

Kauno klinikų Akušerijos ir ginekologijos klinikoje - svarbūs mokymai specialistams

Kauno klinikų Akušerijos ir ginekologijos klinika kartu su Europos Ginekologinės chirurgijos akademija bei su vie

Algirdo Kumžos knygos „Rasa. Po angelo sparnu” pristatymas

2011 metų rudenį palangiškei Rasai Rojienei buvo nustatyta ketvirtosios stadijos sarkoma, Rasai buvo 27-eri, o li

Uostamiestyje – nemokama patikra dėl melanomos

Melanoma – agresyviausias odos vėžys, užklumpantis vis jaunesnius žmones. Kasmet šia liga Lietuvoje suserga

Kraujo ligos: ką svarbu žinoti pacientui?

Lietuvoje per metus diagnozuojama apie 1500 kraujo ligų atvejų. Kokie yra kraujo ligų simptomai? Koks gydymas yra priein

Išsėtinės sklerozės draugijos renginys

Gegužės 30 d. 15 val. Klaipėdos apskrities viešosios Ievos Simonaitytės bibliotekos Konferencijų salėje vyks Klai

Pasaulinę aortos dieną – nemokama patikra

Rugsėjo 19-oji yra Pasaulinė aortos diena. Rugsėjo 20 d. šia proga Vilniuje, Katedros aikštėje bus įrengta

Žygis pajūriu: "Artimieji turi žinoti tavo sprendimą apie organų donorystę“

Šį šeštadienį (rugsėjo 21 d.) Smiltynėje (Klaipėdoje) vyks žygis pėsčiomis pajūriu - žinutę apie or

1675 organų donorams pagerbti 18-oje miestų liepsnos „Gyvasties“ žvakelės

Asociacijos „Gyvastis“ organizuojama iniciatyva organų donorams atminti kasmet sulaukia vis daugiau susidomė

Renginys Kaune: kaip gyventi, sergant cukriniu diabetu?

Cukriniu diabetu pasaulyje serga 425 milijonai žmonių – 1 iš 11 planetos gyventojų, ir vienas iš dvi

Vilniuje – kaulų čiulpų donorų registracijos "Pop Up"

Gruodžio 19 d., ketvirtadienį, nuo 11 iki 20 val. Vilniuje Pylimo g. 19 esančiame „Caffeine Roasters“ įvyks

Padėka donorams – donorus sergėjantis angelas

      Angelų kalvoje rugsėjo 13 d. (se

Nemokamai ir be siuntimo pasitikrinkime aortos diametrą

VUL Santaros klinikų medikai kviečia rugsėjo 19 d. nuo 11 iki 17 val. prie Mo muziejaus (Vilniuje, Pylimo g. 17) į Pasau

Sieks atkreipti visuomenės dėmesį į sudėtingą ir klastingą širdies ligą

Širdys nustoja plakusios ne tik dėl COVID-19 ligos – taip tvirtina kardiologai. Kiek daugiau nei metus visą

Sieks atkreipti visuomenės dėmesį į sudėtingą ir klastingą širdies ligą

Širdys nustoja plakusios ne tik dėl COVID-19 ligos – taip tvirtina kardiologai. Kiek daugiau nei metus visą

Šv. Magdalenos naktis – dėmesys ligai, kuri gresia kas vienuoliktai moteriai

Lietuvoje kasmet diagnozuojama daugiau nei 1500 naujų krūties vėžio atvejų, Europos Sąjungoje šia liga suserga ka

Populiarios žymos
Ligos ir sveikata Man rūpiŠirdis ir kraujotakaPlaučiai ir kvėpavimas Virškinimo sistemaEndokrininė sistemaSmegenys, nervų sistemaŠlapimo organai ir inkstaiStuburas, kaulai, sąnariaiRaumenys ir sausgyslėsLytiniai organaiOda, plaukai ir nagaiLimfmazgiai, kraujas ir imunitetas KrūtysAkysAusys, nosis ir gerklėBurna ir dantysPsichikos ligos
 
Simptomai ir ligosAlergijaVėžys ir kraujo ligos Peršalimas ir gripasTemperatūraKūno tirpimasSkauda šonąSvorio kontrolė, valgymo sutrikimaiPriklausomybėMiego sutrikimaiNuovargis ir silpnumasInfekcinės ligos
 
PsichologijaSveika vaikystėŽvilgsnis į praeitįSveika senatvė
Sveikata be vaistų Gydymas augalaisAlternatyvios terapijosSveika mitybaSveikas ir gražus kūnasVegetarų virtuvėJogaSveika dvasiaSėkmės istorijos
Renginiai
Konsultuoja specialistas
Sveikatos apsauga
Nuomonė
ReklamaApie musLigų klasifikatoriusKontaktai
2015-20 © UAB “Vlmedicina”. Visos teises saugomos | sprendimas webmod: Svetainių kūrimas
Į viršų